Description
External Links
#
Expression
#
Biological Properties

Proteome  -  SMDBP000008  ( P49755 )

Description

  • IDSMDBP000008
  • NameTransmembrane emp24 domain-containing protein 10 (Protein TMED10) (21 kDa transmembrane-trafficking protein) (S31I125) (S31III125) (Tmp-21-I) (Transmembrane protein Tmp21) (p23) (p24 family protein delta-1) (p24delta1) (p24delta)
  • OrganismHomo sapiens (Human)
  • Gene SymbolTMED10
  • Gene Synonymsp24d1; TMP21; p24delta1; S31III125; P24(DELTA); Tmp-21-I; p23; S31I125
  • ChromosomeGRCh38 chr14:75131469-75176612; hg19 chr14:75598172-75643315
  • Gene Sequence
    GAGGCCTTCGGTGGTGAACGAGTCTCCAGCACCATGTCTGGTTTGTCTGGCCCACCAGCCCGGCGCGGCCCTTTTCCGTTAGCGTTGCTGCTTTTGTTCCTGCTCGGCCCCAGATTGGTCCTTGCCATCTCCTTCCATCTGCCCATTAACTCTCGCAAGTGCCTCCGTGAGGAGATTCACAAGGACCTGC Show more... 
  • Protein Sequence
    MSGLSGPPARRGPFPLALLLLFLLGPRLVLAISFHLPINSRKCLREEIHKDLLVTGAYEISDQSGGAGGLRSHLKITDSAGHILYSKEDATKGKFAFTTEDYDMFEVCFESKGTGRIPDQLVILDMKHGVEAKNYEEIAKVEKLKPLEVELRRLEDLSESIVNDFAYMKKREEEMRDTNESTNTRVLYFS  Show more... 
  • Protein Length219
  • Mass24976.0

Expression

  • Abundance
    Export

    Organism part

    Protocol Analysis method Abundance Raw Data Provider
    29.07564
    29.94000
    28.61897
    24.19414
    22.91050
    30.09751
    0.30000
    0.30000

Biological Properties

  • General FunctionCargo receptor involved in protein vesicular trafficking and quality control in the endoplasmic reticulum (ER) and Golgi (PubMed:10052452, PubMed:11726511, PubMed:16641999, PubMed:17288597, PubMed:19296914, PubMed:20427317, PubMed:21219331, PubMed:27569046). The p24 protein family is a group of transmembrane proteins that bind coat protein complex I/COPI and coat protein complex II/COPII involved in vesicular trafficking between the membranes (PubMed:10052452). Acts at the lumenal side for incorporation of secretory cargo molecules into transport vesicles and involved in vesicle coat formation at the cytoplasmic side (PubMed:20427317, PubMed:27569046). Mainly functions in the early secretory pathway and cycles between the ER, ER-Golgi intermediate compartment (ERGIC) and Golgi, mediating cargo transport through COPI and COPII-coated vesicles (PubMed:10052452, PubMed:10852829, PubMed:12237308). In COPII vesicle-mediated anterograde transport, involved in the transport of GPI-anchored proteins by acting together with TMED2 as their cargo receptor; the function specifically implies SEC24C and SEC24D of the COPII vesicle coat and lipid raft-like microdomains of the ER (PubMed:20427317, PubMed:27569046). Recognizes GPI anchors structural remodeled in the ER by the GPI inositol-deacylase/PGAP1 and the metallophosphoesterase MPPE1/PGAP5 (By similarity). In COPI vesicle-mediated retrograde transport, involved in the biogenesis of COPI vesicles and vesicle coat recruitment (PubMed:11726511). Involved in trafficking of amyloid beta A4 protein and soluble APP-beta release (independent from the modulation of gamma-secretase activity) (PubMed:17288597). Involved in the KDELR2-mediated retrograde transport of the toxin A subunit (CTX-A-K63)together with COPI and the COOH terminus of KDELR2 (By similarity). On Golgi membranes, acts as primary receptor for ARF1-GDP, a GTP-binding protein involved in COPI-vesicle formation (PubMed:11726511). Increases coatomer-dependent GTPase-activating activity of ARFGAP2 which mediates the hydrolysis of ARF1-bound GTP and therefore modulates protein trafficking from the Golgi apparatus (PubMed:19296914). Involved in the exocytic trafficking of G protein-coupled receptors F2LR1/PAR2 (trypsin and tryspin-like enzyme receptor), OPRM1 (opioid receptor) and P2RY4 (UTD and UDP receptor) from the Golgi to the plasma membrane, thus contributing to receptor resensitization (PubMed:21219331). In addition to its cargo receptor activity, may also act as a protein channel after oligomerization, facilitating the post-translational entry of leaderless cytoplasmic cargo into the ERGIC (PubMed:32272059). Involved in the translocation into ERGIC, the vesicle entry and the secretion of leaderless cargos (lacking the secretion signal sequence), including the mature form of interleukin 1/IL-1 family members, the alpha-crystallin B chain HSPB5, the carbohydrate-binding proteins galectin-1/LGALS1 and galectin-3/LGALS3, the microtubule-associated protein Tau/MAPT, and the annexin A1/ANXA1; the translocation process is dependent on cargo protein unfolding and enhanced by chaperones HSP90AB1 and HSP90B1/GRP9 (PubMed:32272059). Could also associates with the presenilin-dependent gamma-secretase complex in order to regulate gamma-cleavages of the amyloid beta A4 protein to yield amyloid-beta 40/Abeta40 (PubMed:16641999). {ECO:0000250|UniProtKB:Q28735, ECO:0000250|UniProtKB:Q63584, ECO:0000269|PubMed:10052452, ECO:0000269|PubMed:10852829, ECO:0000269|PubMed:11726511, ECO:0000269|PubMed:12237308, ECO:0000269|PubMed:16641999, ECO:0000269|PubMed:17288597, ECO:0000269|PubMed:19296914, ECO:0000269|PubMed:20427317, ECO:0000269|PubMed:21219331, ECO:0000269|PubMed:27569046, ECO:0000269|PubMed:32272059, ECO:0000303|PubMed:10052452}.
  • GO – Biological ProcessCOPI-coated vesicle budding [GO:0035964]; COPI coating of Golgi vesicle [GO:0048205]; COPII vesicle coating [GO:0048208]; cytosol to ERGIC protein transport [GO:0106273]; endoplasmic reticulum to Golgi vesicle-mediated transport [GO:0006888]; Golgi organization [GO:0007030]; intracellular protein transport [GO:0006886]; negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process [GO:1902960]; positive regulation of interleukin-1 production [GO:0032732]; positive regulation of protein secretion [GO:0050714]; protein localization to ERGIC [GO:0106272]; regulated exocytosis [GO:0045055]; regulation of amyloid-beta formation [GO:1902003]; retrograde vesicle-mediated transport, Golgi to endoplasmic reticulum [GO:0006890]; vesicle cargo loading [GO:0035459]; vesicle targeting, to, from or within Golgi [GO:0048199]
  • GO – Cellular Componentcis-Golgi network [GO:0005801]; COPI-coated vesicle [GO:0030137]; COPII-coated ER to Golgi transport vesicle [GO:0030134]; endoplasmic reticulum [GO:0005783]; endoplasmic reticulum-Golgi intermediate compartment [GO:0005793]; endoplasmic reticulum-Golgi intermediate compartment membrane [GO:0033116]; endoplasmic reticulum membrane [GO:0005789]; ER to Golgi transport vesicle membrane [GO:0012507]; gamma-secretase complex [GO:0070765]; Golgi apparatus [GO:0005794]; Golgi membrane [GO:0000139]; integral component of membrane [GO:0016021]; melanosome [GO:0042470]; plasma membrane [GO:0005886]; secretory granule membrane [GO:0030667]; trans-Golgi network transport vesicle [GO:0030140]; transport vesicle [GO:0030133]; zymogen granule membrane [GO:0042589]
  • GO – Molecular Functionprotein transmembrane transporter activity [GO:0008320]; syntaxin binding [GO:0019905]