Description
External Links
#
Expression
#
Biological Properties

Proteome  -  SMDBP000010  ( P11532 )

Description

  • IDSMDBP000010
  • NameDystrophin
  • OrganismHomo sapiens (Human)
  • Gene SymbolDMD
  • Gene SynonymsBMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272; MRX85
  • ChromosomeGRCh38 chrX:31119222-32412228; hg19 chrX:31137339-33357505
  • Gene Sequence
    CTGAGAAAGACAGATTGCAATGACTGAGATGATTTTGCTAATTTTTTTTCCAGCCTATTTCCTTAATGTACGTGATATTGTGATTGATTTTCATGCAGAGATCCCTGATCCTATAGTTTTGTTTGCTATTTATTTTTCTCCTTCACATTTTTTTTCTATCAACAGAGCTGAATGAGTGCCAGGAAGCTGC Show more... 
  • Protein Sequence
    MLWWEEVEDCYEREDVQKKTFTKWVNAQFSKFGKQHIENLFSDLQDGRRLLDLLEGLTGQKLPKEKGSTRVHALNNVNKALRVLQNNNVDLVNIGSTDIVDGNHKLTLGLIWNIILHWQVKNVMKNIMAGLQQTNSEKILLSWVRQSTRNYPQVNVINFTTSWSDGLALNALIHSHRPDLFDWNSVVCQQ  Show more... 
  • Protein Length3685
  • Mass426750.0

Expression

  • Abundance
    Export

    Organism part

    		 Protocol Analysis method Abundance Raw Data Provider
    23.99774
    25.71369
    16.42803
    19.83793

Biological Properties

  • General FunctionAnchors the extracellular matrix to the cytoskeleton via F-actin. Ligand for dystroglycan. Component of the dystrophin-associated glycoprotein complex which accumulates at the neuromuscular junction (NMJ) and at a variety of synapses in the peripheral and central nervous systems and has a structural function in stabilizing the sarcolemma. Also implicated in signaling events and synaptic transmission. {ECO:0000250|UniProtKB:P11531, ECO:0000269|PubMed:16710609}.
  • GO – Biological Processactin cytoskeleton organization [GO:0030036]; cardiac muscle cell action potential [GO:0086001]; cardiac muscle contraction [GO:0060048]; cellular protein-containing complex assembly [GO:0034622]; cellular protein localization [GO:0034613]; maintenance of blood-brain barrier [GO:0035633]; motile cilium assembly [GO:0044458]; muscle cell cellular homeostasis [GO:0046716]; muscle cell development [GO:0055001]; muscle organ development [GO:0007517]; negative regulation of peptidyl-cysteine S-nitrosylation [GO:1902083]; negative regulation of peptidyl-serine phosphorylation [GO:0033137]; neuron development [GO:0048666]; peptide biosynthetic process [GO:0043043]; positive regulation of neuron differentiation [GO:0045666]; positive regulation of neuron projection development [GO:0010976]; positive regulation of sodium ion transmembrane transporter activity [GO:2000651]; regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion [GO:0010881]; regulation of cellular response to growth factor stimulus [GO:0090287]; regulation of heart rate [GO:0002027]; regulation of muscle system process [GO:0090257]; regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum [GO:0010880]; regulation of ryanodine-sensitive calcium-release channel activity [GO:0060314]; regulation of skeletal muscle contraction [GO:0014819]; regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion [GO:0014809]; regulation of voltage-gated calcium channel activity [GO:1901385]; response to muscle stretch [GO:0035994]; skeletal muscle tissue development [GO:0007519]
  • GO – Cellular Componentcell junction [GO:0030054]; cell projection [GO:0042995]; cell-substrate junction [GO:0030055]; cell surface [GO:0009986]; cortical actin cytoskeleton [GO:0030864]; costamere [GO:0043034]; cytoskeleton [GO:0005856]; cytosol [GO:0005829]; dystrophin-associated glycoprotein complex [GO:0016010]; filopodium [GO:0030175]; filopodium membrane [GO:0031527]; membrane raft [GO:0045121]; neuron projection terminus [GO:0044306]; nucleus [GO:0005634]; plasma membrane [GO:0005886]; postsynaptic membrane [GO:0045211]; protein-containing complex [GO:0032991]; sarcolemma [GO:0042383]; synapse [GO:0045202]; syntrophin complex [GO:0016013]; Z disc [GO:0030018]
  • GO – Molecular Functionactin binding [GO:0003779]; actin filament binding [GO:0051015]; dystroglycan binding [GO:0002162]; myosin binding [GO:0017022]; nitric-oxide synthase binding [GO:0050998]; structural constituent of cytoskeleton [GO:0005200]; structural constituent of muscle [GO:0008307]; vinculin binding [GO:0017166]; zinc ion binding [GO:0008270]