Proteome - SMDBP000019 ( P04406 )
Description
- IDSMDBP000019
- NameGlyceraldehyde-3-phosphate dehydrogenase (GAPDH) (EC 1.2.1.12) (Peptidyl-cysteine S-nitrosylase GAPDH) (EC 2.6.99.-)
- OrganismHomo sapiens (Human)
- Gene SymbolGAPDH
- Gene SynonymsG3PD; GAPD; HEL-S-162eP
- ChromosomeGRCh38 chr12:6534517-6538371; hg19 chr12:6643683-6647537
- Gene Sequence
GCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCACATCGCTCAGACACCATGGGGAAGGTGAAGGTCGGAGTCAACGGATTTGGTCGTATTGGGCGCCTGGTCACCAGGGCTGCTTTTAACTCTGGTAAAGTGGATATTGTTGCCATCAATGACCCCTTCATT Show more...
- Protein Sequence
MGKVKVGVNGFGRIGRLVTRAAFNSGKVDIVAINDPFIDLNYMVYMFQYDSTHGKFHGTVKAENGKLVINGNPITIFQERDPSKIKWGDAGAEYVVESTGVFTTMEKAGAHLQGGAKRVIISAPSADAPMFVMGVNHEKYDNSLKIISNASCTTNCLAPLAKVIHDNFGIVEGLMTTVHAITATQKTVDG Show more...
- Protein Length335
- Mass36053.0
External Links
- UniprotP04406
- HGNC4141
- HPAENSG00000111640
- GeneCardsGAPDH
Expression
- Abundance
Export
Loci
- Sperm LociEquatorial and principal piece
Sperm Loci
Immunocytochemistry of washed motile ejaculated human spermatozoa incubated with antibodies against epididymal secretory proteins and testicular proteins (right panels, merged micrographs of fluorescence staining). Red staining (by PI) indicates the nuclei and green staining (by FITC) indicates the location of HEL-S-162eP on spermatozoa. Each bar represents 5 um.
Epididymis and Testis Loci
Immunohistochemical location of sperm-located and nonlocated proteins in tissue sections. proteins located in different regions (left panels, Caput; middle left panels, Corpus; middle right panels, Cauda; right panels, Testis) in different tissue compartments.1, negative control, preimmune rabbit serum; 2, HEL-S-181mP, in the epididymal epithelium , on microvilli and the testis of all four regions; 3, HEL-S-100n, in the epididymal epithelium , on microvilli and the testis of all four regions. Each bar represents 200 um.
Biological Properties
- General FunctionHas both glyceraldehyde-3-phosphate dehydrogenase and nitrosylase activities, thereby playing a role in glycolysis and nuclear functions, respectively (PubMed:3170585, PubMed:11724794). Glyceraldehyde-3-phosphate dehydrogenase is a key enzyme in glycolysis that catalyzes the first step of the pathway by converting D-glyceraldehyde 3-phosphate (G3P) into 3-phospho-D-glyceroyl phosphate (PubMed:3170585, PubMed:11724794). Modulates the organization and assembly of the cytoskeleton (By similarity). Facilitates the CHP1-dependent microtubule and membrane associations through its ability to stimulate the binding of CHP1 to microtubules (By similarity). Component of the GAIT (gamma interferon-activated inhibitor of translation) complex which mediates interferon-gamma-induced transcript-selective translation inhibition in inflammation processes (PubMed:23071094). Upon interferon-gamma treatment assembles into the GAIT complex which binds to stem loop-containing GAIT elements in the 3'-UTR of diverse inflammatory mRNAs (such as ceruplasmin) and suppresses their translation (PubMed:23071094). Also plays a role in innate immunity by promoting TNF-induced NF-kappa-B activation and type I interferon production, via interaction with TRAF2 and TRAF3, respectively (PubMed:23332158, PubMed:27387501). Participates in nuclear events including transcription, RNA transport, DNA replication and apoptosis (By similarity). Nuclear functions are probably due to the nitrosylase activity that mediates cysteine S-nitrosylation of nuclear target proteins such as SIRT1, HDAC2 and PRKDC (By similarity). {ECO:0000250|UniProtKB:P04797, ECO:0000269|PubMed:11724794, ECO:0000269|PubMed:23071094, ECO:0000269|PubMed:23332158, ECO:0000269|PubMed:27387501, ECO:0000269|PubMed:3170585}.
- GO – Biological Processantimicrobial humoral immune response mediated by antimicrobial peptide [GO:0061844]; cellular response to interferon-gamma [GO:0071346]; defense response to fungus [GO:0050832]; glucose metabolic process [GO:0006006]; glycolytic process [GO:0006096]; killing by host of symbiont cells [GO:0051873]; killing of cells of other organism [GO:0031640]; microtubule cytoskeleton organization [GO:0000226]; negative regulation of endopeptidase activity [GO:0010951]; negative regulation of translation [GO:0017148]; neuron apoptotic process [GO:0051402]; peptidyl-cysteine S-trans-nitrosylation [GO:0035606]; positive regulation of cytokine production [GO:0001819]; positive regulation of I-kappaB kinase/NF-kappaB signaling [GO:0043123]; positive regulation of type I interferon production [GO:0032481]; protein stabilization [GO:0050821]; regulation of macroautophagy [GO:0016241]
- GO – Cellular Componentcytoplasm [GO:0005737]; cytosol [GO:0005829]; extracellular exosome [GO:0070062]; GAIT complex [GO:0097452]; intracellular membrane-bounded organelle [GO:0043231]; lipid droplet [GO:0005811]; membrane [GO:0016020]; microtubule cytoskeleton [GO:0015630]; nuclear membrane [GO:0031965]; nucleus [GO:0005634]; perinuclear region of cytoplasm [GO:0048471]; plasma membrane [GO:0005886]; ribonucleoprotein complex [GO:1990904]; vesicle [GO:0031982]
- GO – Molecular Functionaspartic-type endopeptidase inhibitor activity [GO:0019828]; disordered domain specific binding [GO:0097718]; glyceraldehyde-3-phosphate dehydrogenase (NAD+) (phosphorylating) activity [GO:0004365]; identical protein binding [GO:0042802]; microtubule binding [GO:0008017]; NAD binding [GO:0051287]; NADP binding [GO:0050661]; peptidyl-cysteine S-nitrosylase activity [GO:0035605]