GCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCACATCGCTCAGACACCATGGGGAAGGTGAAGGTCGGAGTCAACGGATTTGGTCGTATTGGGCGCCTGGTCACCAGGGCTGCTTTTAACTCTGGTAAAGTGGATATTGTTGCCATCAATGACCCCTTCATT
Show more...
GCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCACATCGCTCAGACACCATGGGGAAGGTGAAGGTCGGAGTCAACGGATTTGGTCGTATTGGGCGCCTGGTCACCAGGGCTGCTTTTAACTCTGGTAAAGTGGATATTGTTGCCATCAATGACCCCTTCATTGACCTCAACTACATGGTTTACATGTTCCAATATGATTCCACCCATGGCAAATTCCATGGCACCGTCAAGGCTGAGAACGGGAAGCTTGTCATCAATGGAAATCCCATCACCATCTTCCAGGAGCGAGATCCCTCCAAAATCAAGTGGGGCGATGCTGGCGCTGAGTACGTCGTGGAGTCCACTGGCGTCTTCACCACCATGGAGAAGGCTGGGGCTCATTTGCAGGGGGGAGCCAAAAGGGTCATCATCTCTGCCCCCTCTGCTGATGCCCCCATGTTCGTCATGGGTGTGAACCATGAGAAGTATGACAACGAATTTGGCTACAGCAACAGGGTGGTGGACCTCATGGCCCACATGGCCTCCAAGGAGTAAGACCCCTGGACCACCAGCCCCAGCAAGAGCACAAGAGGAAGAGAGAGACCCTCACTGCTGGGGAGTCCCTGCCACACTCAGTCCCCCACCACACTGAATCTCCCCTCCTCACAGTTGCCATGTAGACCCCTTGAAGAGGGGAGGGGCCTAGGGAGCCGCACCTTGTCATGTACCATCAATAAAGTACCCTGTGCTCAACCA
Close
General FunctionHas both glyceraldehyde-3-phosphate dehydrogenase and nitrosylase activities, thereby playing a role in glycolysis and nuclear functions, respectively (PubMed:3170585, PubMed:11724794). Glyceraldehyde-3-phosphate dehydrogenase is a key enzyme in glycolysis that catalyzes the first step of the pathway by converting D-glyceraldehyde 3-phosphate (G3P) into 3-phospho-D-glyceroyl phosphate (PubMed:3170585, PubMed:11724794). Modulates the organization and assembly of the cytoskeleton (By similarity). Facilitates the CHP1-dependent microtubule and membrane associations through its ability to stimulate the binding of CHP1 to microtubules (By similarity). Component of the GAIT (gamma interferon-activated inhibitor of translation) complex which mediates interferon-gamma-induced transcript-selective translation inhibition in inflammation processes (PubMed:23071094). Upon interferon-gamma treatment assembles into the GAIT complex which binds to stem loop-containing GAIT elements in the 3'-UTR of diverse inflammatory mRNAs (such as ceruplasmin) and suppresses their translation (PubMed:23071094). Also plays a role in innate immunity by promoting TNF-induced NF-kappa-B activation and type I interferon production, via interaction with TRAF2 and TRAF3, respectively (PubMed:23332158, PubMed:27387501). Participates in nuclear events including transcription, RNA transport, DNA replication and apoptosis (By similarity). Nuclear functions are probably due to the nitrosylase activity that mediates cysteine S-nitrosylation of nuclear target proteins such as SIRT1, HDAC2 and PRKDC (By similarity). {ECO:0000250|UniProtKB:P04797, ECO:0000269|PubMed:11724794, ECO:0000269|PubMed:23071094, ECO:0000269|PubMed:23332158, ECO:0000269|PubMed:27387501, ECO:0000269|PubMed:3170585}.
GO – Biological Processantimicrobial humoral immune response mediated by antimicrobial peptide [GO:0061844]; cellular response to interferon-gamma [GO:0071346]; defense response to fungus [GO:0050832]; glucose metabolic process [GO:0006006]; glycolytic process [GO:0006096]; killing by host of symbiont cells [GO:0051873]; killing of cells of other organism [GO:0031640]; microtubule cytoskeleton organization [GO:0000226]; negative regulation of endopeptidase activity [GO:0010951]; negative regulation of translation [GO:0017148]; neuron apoptotic process [GO:0051402]; peptidyl-cysteine S-trans-nitrosylation [GO:0035606]; positive regulation of cytokine production [GO:0001819]; positive regulation of I-kappaB kinase/NF-kappaB signaling [GO:0043123]; positive regulation of type I interferon production [GO:0032481]; protein stabilization [GO:0050821]; regulation of macroautophagy [GO:0016241]